Revista Internacional de Andrología. 2025; 23(1): 76-87. doi: 10.22514/j.androl.2025.009
Original Research

Effect of quercetin on the IRE1-XBP1 apoptotic pathway in Cadmium-treated rat testes
Efecto de la quercetina en la vía apoptótica IRE1-XBP1 en testículos de rata tratados con Cadmio

Junbing Mao1, Bing Xu1, Huali Zhu2, Yaning Shi1, Wenlong Zhang1, Zongping Liu3, Jicang Wang1,*,

1College of Animal Science and Technology, Henan University of Science and Technology, 471023 Luoyang, Henan, China

2Law Hospital, Henan University of Science and Technology, 471023 Luoyang, Henan, China

3College of Veterinary Medicine, Yangzhou University, 225009 Yangzhou, Jiangsu, China

*Corresponding Author(s):wangjicang@haust.edu.cn (Jicang Wang)

History Submitted: 12 July 2024 | Accepted: 12 August 2024 | Published: 30 March 2025
Copyright:  ©2025 The Author(s). Published by MRE Press.
This is an open access article under the CC BY 4.0 license (https://creativecommons.org/licenses/by/4.0/).

Collapse table of contents

Abstract

Background: Cadmium (Cd) is a recognized toxic metal with serious reproductive toxicity in both animals and humans, while quercetin (Que) is considered the potent antioxidant among flavonoid compounds. However, little is known about the alleviating effect of Que on Cd-induced testicular cell apoptosis. This experiment aims to investigate the alleviating effect of Que on Cd-induced testicular cell apoptosis in rats. Methods: Twenty-four four-week-old male Sprague-Dawley rats were randomly divided into control group, Cd group, Cd + Que group and Que group. Following the assigned treatments, the testicular tissues of the rats were examined 28 days later. The levels of malondialdehyde (MDA) and reducing glutathione (GSH) in testicular tissue were measured via colorimetry, with HE (hematoxylin and eosin) and TUNEL (a TdT-UTP nick end labeling) staining employed to assess tissue damage and cell apoptosis. Total mRNA (messenger RNA) was extracted from testicular tissue using the Trizol method, and reverse transcription was followed by quantitative real-time PCR (Polymerase Chain Reaction) to measure the expression levels of relevant genes. The expression of related proteins was assessed using Western blot. Results: The data revealed that Cd exposure led to a decrease in body weight and a significant increase in MDA and GSH content in testicular tissue. In addition, histopathological examination of the tissue revealed extensive pathological changes, and TUNEL staining showed significant cell apoptosis in the tissue. Furthermore, Cd treatment promoted the expression of relevant genes, including IRE1α (inositol-requiring kinase 1), Caspase-12, XBP1 (X box-binding protein 1), GRP78 (glucose-regulated protein 78), Bax and Caspase-3, in the IRE1-XBP1 apoptosis pathway. Meanwhile, the anti-apoptotic gene Bcl-2 was significantly decreased. However, the application of Que significantly reduced these alterations and cellular damage induced by Cd. Conclusions: Our study suggests that Que can mitigate testicular tissue damage and cell apoptosis resulting from Cd exposure by suppressing oxidative stress and the IRE1-XBP1 pathway.

Resumen
Antecedentes: El cadmio (Cd) es un metal tóxico reconocido con grave toxicidad reproductiva tanto en animales como en humanos, mientras que la quercetina (Que) se considera el potente antioxidante entre los compuestos flavonoides. Sin embargo, poco se sabe sobre el efecto paliativo de Que en la apoptosis de células testiculares inducida por Cd. Este experimento tiene como objetivo investigar el efecto paliativo de Que en la apoptosis de células testiculares inducida por Cd en ratas. Métodos: Veinticuatro ratas macho Sprague-Dawley de cuatro semanas de edad fueron aclimatadas durante una semana y divididas aleatoriamente en grupo control, grupo Cd, grupo Cd + Que y grupo Que. Tras los tratamientos asignados, se examinaron los tejidos testiculares de las ratas 28 días después. Los niveles de malondialdehído (MDA) y glutatión reductor (GSH) en el tejido testicular se midieron mediante colorimetría, y se emplearon las tinciones HE (hematoxilina y eosina) y TUNEL (a TdT-UTP nick end labeling) para evaluar el daño tisular y la apoptosis celular. Se extrajo el ARNm total (ARN mensajero) del tejido testicular mediante el método Trizol y se realizó la transcripción inversa seguida de la PCR cuantitativa en tiempo real (reacción en cadena de la polimerasa) para medir los niveles de expresión de los genes relevantes. Resultados: Los datos revelaron que la exposición al Cd provocó una disminución del peso corporal y un aumento significativo del contenido de MDA y GSH en el tejido testicular. Además, el examen histopatológico del tejido reveló cambios patológicos extensos, y la tinción TUNEL mostró una apoptosis celular significativa en el tejido. Además, el tratamiento con Cd fomentó la expresión de genes relevantes, como IRE1α (inositol-requiring kinase 1), Caspasa-12, XBP1 (X box-binding protein 1), GRP78 (glucose-regulated protein 78), Bax y Caspasa-3, en la vía de apoptosis IRE1-XBP1. Mientras tanto, el gen anti-apoptótico Bcl-2 disminuyó significativamente. Sin embargo, la aplicación de Que redujo significativamente estas alteraciones y el daño celular inducido por el Cd. Conclusiones: Nuestro estudio sugiere que Que puede mitigar el daño testicular y la apoptosis celular resultantes de la exposición al Cd mediante la supresión del estrés oxidativo y de la vía IRE1-XBP1.

Keywords:Cadmium;Testis;Toxicity;Apoptosis;Quercetin
Palabras Clave:
Cadmio;Testículo;Toxicidad;Apoptosis;Quercetina
PDF(11.01 MB)|EndNote (RIS)|BibTeX|RefMan|RefWorks

Cite this article

Junbing Mao, Bing Xu, Huali Zhu, Yaning Shi, Wenlong Zhang, Zongping Liu, Jicang Wang. Effect of quercetin on the IRE1-XBP1 apoptotic pathway in Cadmium-treated rat testes. Revista Internacional de Andrología. 2025; 23(1): 76-87. doi: 10.22514/j.androl.2025.009

1. Introduction

Millions of people around the world are inevitably exposed to cadmium (Cd), a heavy metal that is ubiquitous in the Earth’s crust, through occupational and non-occupational pathways [1]. In the occupational pathway, individuals working in an environment with cadmium levels above 0.005 μg/m3 are at risk of many diseases, including lung cancer, prostate cancer, testicular impairment and bone disease [2, 3, 4, 5]. In the non-occupational pathway, chronic low-level Cd intake is primarily attributed to smoking and the consumption of food and water contaminated with this heavy metal [6]. The elimination rate of Cd is extremely low in the organism [1]. After absorption, Cd slowly accumulates in high concentrations and persists in the body, mainly in the liver, kidneys and testes, gradually creating a potential health risk [7]. The literature extensively discusses the impacts of Cd accumulation on the reproductive system of animals [8, 9, 10, 11]. Exposure Cd is known to decrease the density, volume and number of spermatozoa in semen, as well as to increase the proportion of immature spermatozoa [12]. In addition, a recent body of literature has indicated that cadmium can also lower the levels of testosterone in people’s blood serum, and it can directly or indirectly reduce human libido and fertility [13, 14, 15].

Cd is known for its long half-life of 10 to 30 years and the difficulty of eliminating it from the body [16]. When present in low levels, Cd can suppress cellular respiration and oxidative phosphorylation [17]. However, high levels of Cd can lead to anemia and ataxia [18, 19, 20]. Cd itself cannot produce free radicals; however, it possesses the ability to catalyze the generation of different reactive species, such as hydroxyl radicals, nitric oxide radicals and superoxide radicals, consequently resulting in the production of reactive oxygen species (ROS) and, indirectly, oxidative stress [21, 22]. The production of ROS and free radicals generated by Cd are considered among the factors contributing to Cd’s toxicity towards the testes [23]. When cells are exposed to Cd, the endoplasmic reticulum (ER) emerges as the primary target organelle [24]. High levels of ROS can trigger an unfolded protein response (UPR) in the ER, which acts as a protective mechanism against cellular damage and aims to restore normal cell function. However, if the accumulation of unfolded and misfolded proteins overwhelms this protective response, then it can lead to ER stress (ERS). ERS can activate various pathways such as inositol-requiring kinase 1 and X box-binding protein 1 (IRE1-XBP1), ultimately resulting in apoptosis [24, 25]. This mechanism helps explain the role of Cd in apoptosis [26]. Recent studies provide growing evidence that Cd induces ERS-induced apoptosis [25, 27, 28].

Quercetin (Que), a naturally occurring bioflavonoid, is abundantly found in commonly consumed fruits such as apples, blueberries, onions and leeks. It exhibits a wide range of significant biological properties, including antioxidant, anticancer, antiviral, antithrombotic, anti-ischemic, anti-inflammatory and anti-allergic activities [29], which contribute to overall health improvement and disease prevention. Que has been reported to utilize various mechanisms to combat ROS. These mechanisms include its potent anti-free radical properties targeting hydroxyl radicals, peroxides and superoxide anions. It can also inhibit the activities of xanthine oxidase, cyclooxygenase and lipoxygenase enzymes, thereby reducing the generation of superoxide anions [30]. Moreover, it has the ability to form chelates with metals such as iron and copper. Thus when applied to Cd poisoning, Que can mitigate oxidative stress and degenerative diseases in different tissues and organs of the body [31]. Indeed, Que has been demonstrated to mitigate Cd-induced cellular toxicity by diminishing lipid peroxidation and augmenting intracellular antioxidant capabilities [32].

Cd, an extremely toxic heavy metal element, poses a significant threat to the health of humans and animals worldwide due to its ability to accumulate in the food chain. Cd poisoning can result in significant harm to testicular tissue, inducing widespread apoptosis of spermatogenic cells in male rats, ultimately leading to a marked reduction in both the quality and quantity of sperm, and potentially resulting in sterility [26]. Que, with its wide distribution and multiple biological activities, has gradually emerged as a novelty in medical research. In this experiment, we established an animal model of Cd-treated rats to investigate the effect of Que on the expression of signaling molecules related to the IRE1-XBP1 apoptotic pathway in the testes of Cd-treated rats.

2. Materials and methods

2.1 Experimental materials

2.1.1 Laboratory animals

Twenty-four four-week-old male Sprague-Dawley rats, acquired from the Experimental Animal Center of Zhengzhou University.

2.1.2 Experimental reagents

Anhydrous CdCl2 (purchased from Aladdin Industrial Corporation, analytical purity), Que (Shanghai Eon Chemical Technology Co., Ltd., purity >97%), malondialdehyde (MDA) kit, reducing glutathione (GSH) kit, hematoxylin-eosin staining solution, a TdT-UTP nick end labeling (TUNEL) staining kit, ethanol solution, methanol (Tianjin Comio Chemical Reagent Co., Ltd.), PCR primers, TRIzol isolation kit (all from Shanghai Sanko Biotechnology Co., Ltd., N1002-01, Shanghai, China), SYBR (Synergetic Binding Reagent) premix, Taq II kit (all from Takara, DRR041A, RR820A, Shiga, Japan), RIPA (Radio Immunoprecipitation Assay) lysis solution, ECL (Enhanced Chemiluminescence) solution, 0.9% saline, formaldehyde solution, skim milk powder (all from Beyotime Biotechnology Co., Ltd.).

2.2 Experimental methods

2.2.1 Grouping of experimental animals

After allowing the purchased rats to adapt to the feeding regimen for one week, they were randomly assigned to one of four groups, each comprising six rats. They were provided with sufficient food and water (the rats were provided with a standard commercial diet and were free to drink under standard laboratory conditions), and their weight was measured weekly. In addition, they were subjected to treatments for 28 days as follows:

A: Control group: Intraperitoneal injection of 0.9% NaCl (sodium chloride) and intragastric administration of 0.9% NaCl.

B: Cd group: Intraperitoneal injection of 2 mg/kg b.w. CdCl2 and intragastric administration of 0.9% NaCl.

C: Cd + Que group: Intraperitoneal injection of 2 mg/kg b.w. CdCl2 and intragastric administration of 100 mg/kg b.w. Que.

D: Que group: Intraperitoneal injection of 0.9% NaCl and intragastric administration of 100 mg/kg b.w. Que.

The dosages of CdCl2 and Que utilized in this study were chosen based on prior research [33, 34].

2.2.2 Experimental sample collection and processing

After four weeks, the rats were fasted for 12 h and then euthanised by neck dislocation. The testicles were then removed, washed by 0.9% saline, allowed to dried and then weighed. Some of the samples were fixed in formalin for the preparation of testicles tissue pathological examination. A portion of testicular tissue weighing 0.500 g was taken and carefully ground in a grinder placed on ice. The ground tissue was mixed with the required ratio of phosphate-buffered saline (PBS) to testicular tissue (1:9). After thorough and complete grinding, the mixture was centrifuged at 12,000 r/min for 10 min. The supernatant was collected and used for the determination of MDA and GSH. The remaining samples were stored at −80 °C for further quantitative analysis.

2.2.3 Determination of antioxidant indicators

The content of MDA and GSH in testicular tissue homogenates was determined using the MDA and GSH assay kit, following the provided instructions.

2.2.4 Histopathologic analysis

Histological lesions were observed through hematoxylin and eosin (HE) staining. Paraffin sections were prepared from the left testis of rat using conventional methods to fix the samples [24, 35], followed by HE staining for observation under an optical microscope (E200 POL, Nikon, Tokyo, Japan).

2.2.5 TUNEL analysis

The TUNEL staining technique was utilized to observe apoptosis. Paraffin sections were prepared and subjected to decolorization using xylene. Subsequently, a new xylene dewaxing treatment was employed. The sections were then soaked in ethanol solutions of varying concentrations (100%, 95%, 85%, 70%, 50%), and DNase-free protease was added for labeling reaction. Following the reaction, the sections were washed with PBS and incubated with TUNEL detection solution for 1 h. After being rinsed with PBS, the sections were sealed using an anti-fluorescence quenching sealing solution and examined and photographed under fluorescence microscopy (Eclipse C1; Nikon, Tokyo, Japan).

2.2.6 Quantitative real-time polymerase chain reaction (RT-qPCR)

RT-qPCR was used to determine the relevant mRNA. The total RNA was extracted from rat testicular tissue using Trizol reagent. The concentration and purity of the RNA samples were analyzed using a nucleic acid concentration analyzer (Nanodrop2000c, Thermo, Waltham, MA, USA). The RNA samples were reverse transcribed to obtain sample cDNA. The cDNA samples were then subjected to RT-qPCR, where they were compared using the cycle threshold method (2−ΔΔct). This method enables the relative quantification of gene expression levels by comparing the cycle threshold values of the target gene with a reference gene. The primers for GRP78, IRE1α, XBP1, Caspase-12, Caspase-3, Bax, Bcl-2 and β-Actin are listed in Table 1.

Table 1.The primer sequence used in this study.
GenesSerial numberPrimers used for PCR
GRP78NM_178021.1F: ATGGTGTGGGAGATCCTGTTTTC
R: CAAGACGCACAGGGATACGC
IRE1αNM_001191926.1F: GCGCAGGTGCAATGACATAC
R: CATGCAAACTTCCGTCCAGG
XBP1NM_001271731.1F: CTGAGTCCGCAGCAGGTG
R: GACCTCTGGGAGTTCCTCCA
Caspase-12NM_130422.1F: TCGGAGAAGGAGCGAGCTTA
R: AGCTGTTTGTCGGAATTGGC
Caspase-3NM_012922.2F: GGAGCTTGGAACGCGAAGAA
R: ACACAAGCCCATTTCAGGGT
BaxNM_017059.2F: CACGTCTGCGGGGAGT
R: CATCCTCTCTGCTCGATCCTG
Bcl-2NM_016993.2F: AGCATGCGACCTCTGTTTGA
R: TCACTTGTGGCCCAGGTATG
β-ActinNM_031144.3F: CACCCGAGAGTACAACCTT
R: TCATCCATGGCGAACTGGTG
PCR: Polymerase Chain Reaction; GRP78: glucose-regulated protein 78; IRE1α: inositol-requiring kinase 1; XBP1: X box-binding protein 1.

2.2.7 Western blot analysis

Extract total protein from testicular tissue, used BCA (Bicinchoninic Acid) detection kit to determine and dilute to 5 μg/μL concentration. After the loading buffer was added, the protein was denatured in a boiling water bath. Subsequently, gel electrophoresis was performed, and the proteins were transferred to a methanol-activated PVDF (Polyvinylidene Fluoride) membrane. The membrane was then incubated with skimmed milk for 2 h to seal the PVDF membrane. At 4 ℃, the PVDF membrane, which had been washed with TBST (Tris Buffered Saline with Tween® 20), was incubated overnight with the primary antibody. After washing the membrane thrice with TBST, it was incubated with the secondary antibody for a duration of 1 h. After 2 min of incubation with the ECL chemiluminescent solution, the membrane was placed inside the exposure box (ChemiDoc Touch, Bio-Rad, Hercules, CA, USA), and a photograph was taken. The antibodies used and their dilution ratios are shown in Table 2 below.

Table 2.The antibodies used in this study.
AntibodiesIdentifierSourcesDilution ratio
GRP78PA1815Proteintech Group1:700
IRE1α27528-1-APProteintech Group1:2000
XBP124868-1-APProteintech Group1:500
Caspase-1255238-1-APABclonal1:1000
Caspase-3A2156Proteintech Group1:3000
Bax60267-1-IgProteintech Group1:10,000
Bcl-260178-1-IgABclonal1:1000
β-ActinACOO4ABclonal1:7000
Horseradish peroxidase-conjugated anti-mouse antibodyHA1006HuaBio1:20,000
Horseradish peroxidase-conjugated anti-rabbit antibodyHA1001HuaBio1:20,000
GPR78: glucose-regulated protein 78; IRE1α: inositol-requiring kinase 1; XBP1: X box-binding protein 1.

2.3 Statistical methods

Statistical analysis was conducted using sing way ANOVA (Analysis of Variance) with SPSS (Statistical Package for the Social Sciences) for windows (version 26; SPSS Inc., Chicago, IL, USA). Results were expressed as mean ± standard deviation (SD). Bonferroni multiple comparisons were conducted to control for error rates at the overall significance level and differences were indicated as critically significant when p < 0.01.

3. Results

3.1 Body weight

As shown in Fig. 1, a significant decrease in body weight occurred in the second, third and fourth weeks of treatment with Cd in the Cd group compared with the control group during the same period (p < 0.01). At 21 days, the body weight of rats in the Cd + Que group was significantly higher than that of the Cd group (p < 0.01). When Cd and Que were administered concurrently, the body weights did not revert to those of the control group. Moreover, there was no statistically significant variation in body weight between the Que group and the control group over the 28-day period.

Effect of Que on body weight gain of Cd-treated rats. All 
measurement results were expressed as mean ± SD (n = 6). **indicates 
significant difference compared with control group at p &lt; 0.01. ##indicates a significant difference of p &lt; 0.01 compared with the 
2 mg/kg Cd group. CdCl2: cadmium chloride; Que: quercetin.

Fig. 1.Effect of Que on body weight gain of Cd-treated rats. All measurement results were expressed as mean ± SD (n = 6). **indicates significant difference compared with control group at p < 0.01. ##indicates a significant difference of p < 0.01 compared with the 2 mg/kg Cd group. CdCl2: cadmium chloride; Que: quercetin.

3.2 MDA and GSH

As shown in Fig. 2A, the MDA content in the Cd group was significantly higher than in the control group, and the difference was highly significant (p < 0.01); the MDA content in the Cd + Que group decreased compared with that in the Cd group and the difference was highly significant (p < 0.01). As shown in Fig. 2B, the GSH content in the Cd group was significantly higher than in the control group, and the difference was highly significant (p < 0.01); the GSH content in the Cd + Que group decreased compared with that in the Cd group and the difference was highly significant (p < 0.01). Furthermore, the levels of MDA and GSH in the Cd + Que group remained higher than those of the control group. No significant difference was observed between the quercetin-treated group and the control group.

MDA and GSH levels assay in testicular tissues. The levels of MDA (A) and GSH (B) in rat testes. All measurement 
results were expressed as mean ± SD (n = 6). **indicates 
significant difference compared with the corresponding control p &lt; 
0.01. ##indicates statistically significant difference between the Cd and 
Cd + Que groups p &lt; 0.01. MDA: malondialdehyde; GSH: glutathione; Cd: 
cadmium; Que: quercetin.

Fig. 2.MDA and GSH levels assay in testicular tissues. The levels of MDA (A) and GSH (B) in rat testes. All measurement results were expressed as mean ± SD (n = 6). **indicates significant difference compared with the corresponding control p < 0.01. ##indicates statistically significant difference between the Cd and Cd + Que groups p < 0.01. MDA: malondialdehyde; GSH: glutathione; Cd: cadmium; Que: quercetin.

3.3 Histological evaluation

As can be seen in the Fig. 3, in the control group (Fig. 3A), testicular tissue cells were lightly stained, structurally intact, with orderly cell arrangement and clear morphology. In the Cd group (Fig. 3B), the testicular histiocytes were densely stained and extensive liquefactive necrosis occurred. In the Cd + Que group (Fig. 3C), the degree of liquefying necrosis was reduced, and some of the spermatogenic tubules returned to normal, and the degree of damage was alleviated compared with that in the Cd group. Que group (Fig. 3D) testicular tissue cells were morphologically normal, and no significant difference from normal testicular tissue cells was found.

HE staining map of rat testes (HE, 40×, scale 
bar = 50 μm). (A) Control group; (B) Cd group (CdCl2, 2 mg/kg b.w.); 
(C) Cd + Que group (CdCl2, 2 mg/kg b.w. + Que, 100 mg/kg b.w.); (D) Que 
group (Que, 100 mg/kg b.w.). Black arrows indicate severe tissue damage.

Fig. 3.HE staining map of rat testes (HE, 40×, scale bar = 50 μm). (A) Control group; (B) Cd group (CdCl2, 2 mg/kg b.w.); (C) Cd + Que group (CdCl2, 2 mg/kg b.w. + Que, 100 mg/kg b.w.); (D) Que group (Que, 100 mg/kg b.w.). Black arrows indicate severe tissue damage.

3.4 TUNEL assay

As shown in Fig. 4, compared with the control group, the Cd group indicated a significant increase in the number of apoptotic cells in the testicular tissue. A decrease in the number of apoptotic cells in the testicular cells of rats exposed to Cd and treated with Que relative to the Cd group.

TUNEL assay of testis-tissue apoptosis. Rats were treated with 
CdCl2 and/or Que for 4 weeks. Positive apoptotic cells are green (red 
arrows, 40×). (A) control group, (B) 2 mg/kg b.w. 
CdCl2 treatment group, (C) 2 mg/kg b.w. CdCl2 
+ 100 mg/kg b.w. Que co-treatment group, (D) 
100 mg/kg b.w. Que co-treatment group.

Fig. 4.TUNEL assay of testis-tissue apoptosis. Rats were treated with CdCl2 and/or Que for 4 weeks. Positive apoptotic cells are green (red arrows, 40×). (A) control group, (B) 2 mg/kg b.w. CdCl2 treatment group, (C) 2 mg/kg b.w. CdCl2 + 100 mg/kg b.w. Que co-treatment group, (D) 100 mg/kg b.w. Que co-treatment group.

3.5 RT-qPCR

As shown in Fig. 5, compared with the control group, the mRNA levels of apoptosis-related genes IRE1α, Caspase-12, XBP1, GRP78, Caspase-3, Bax were significantly increased in the Cd group (p < 0.01). In contrast, in the Cd + Que group, the mRNA levels of IRE1α, Caspase-12, XBP1, GRP78, Caspase-3 and Bax, were significant decreased compared with the Cd group (p < 0.01). In the Cd + Que group, the mRNA expression levels of IRE1α, Caspase-12, XBP1, GRP78, Caspase-3 and Bax genes still increased to the control group. Additionally, for the antiapoptotic gene Bcl-2, compared with the control group, its mRNA levels were significantly decreased in the Cd group (p < 0.01), while in the Cd + Que group, they were significantly increased compared to the Cd group (p < 0.01). In the Cd + Que group, Bcl-2 genes still decreased to the control group. The mRNA expression levels of apoptosis-related genes in the quercetin group did not significantly differ from those in the control group.

The mRNA expression of GRP78, IRE1α, 
XBP1, Caspase-12, Caspase-3, Bax and 
Bcl-2 in the experimental group. Experimental groups included the 
control group, Cd group, Cd + Que group, Que group. All measurement results were 
expressed as mean ± SD (n = 6). **indicates significant difference 
compared with the corresponding control p &lt; 0.01. ##indicates statistically significant difference between the Cd and 
Cd + Que groups p &lt; 0.01. GPR78: glucose-regulated protein 
78; IRE1: inositol-requiring kinase 1; XBP1: X box-binding 
protein 1; Cd: cadmium; Que: quercetin.

Fig. 5.The mRNA expression of GRP78, IRE1α, XBP1, Caspase-12, Caspase-3, Bax and Bcl-2 in the experimental group. Experimental groups included the control group, Cd group, Cd + Que group, Que group. All measurement results were expressed as mean ± SD (n = 6). **indicates significant difference compared with the corresponding control p < 0.01. ##indicates statistically significant difference between the Cd and Cd + Que groups p < 0.01. GPR78: glucose-regulated protein 78; IRE1: inositol-requiring kinase 1; XBP1: X box-binding protein 1; Cd: cadmium; Que: quercetin.

3.6 Western blot

As depicted in Fig. 6, a significant upregulation of apoptosis-related proteins, including IRE1α, Caspase-12, XBP1, GRP78, Caspase-3 and Bax, was observed in the testis tissue of the Cd-exposed group when compared to the control (p < 0.01). Conversely, Bcl-2 expression levels were notably decreased (p < 0.01) in this group. However, the addition of Que to the Cd treatment led to a substantial decrease in the expression of these proteins (p < 0.01) and a concurrent increase in Bcl-2 expression (p < 0.01).

The protein expression of GRP78, IRE1α, XBP1, 
Caspase-12, Caspase-3, Bax and Bcl-2 in the experimental group. Experimental 
groups included the control group, Cd group, Cd + Que group, Que group. The 
levels of GRP78, IRE1α, XBP1, Caspase-12, Caspase-3, Bax and Bcl-2 
proteins (A) were measured by Western blot. The gray scale value analysis results 
of GRP78 (B), IRE1α (C), XBP1 (D), Caspase-12 (E), Caspase-3 (F), Bax 
(G) and Bcl-2 (H) in rat testis. β-Actin was used as a control. Data is 
presented as mean ± SD (n = 6). 
**indicates a significant difference compared to the control group at 
p &lt; 0.01. ##indicates a significant difference of p 
&lt; 0.01 compared to the 2 mg/kg Cd group. “−” means no specific treatment, 
“+” means special treatment. GRP78: glucose-regulated protein 78; 
IRE1α: inositol-requiring kinase 1; XBP1: X box-binding protein 1; 
Caspase-12: cysteine-containing aspartate hydrolase 12; Caspase-3: 
cysteine-containing aspartate hydrolase 3; Cd: cadmium; Que: quercetin; 
CdCl2: cadmium chloride.

Fig. 6.The protein expression of GRP78, IRE1α, XBP1, Caspase-12, Caspase-3, Bax and Bcl-2 in the experimental group. Experimental groups included the control group, Cd group, Cd + Que group, Que group. The levels of GRP78, IRE1α, XBP1, Caspase-12, Caspase-3, Bax and Bcl-2 proteins (A) were measured by Western blot. The gray scale value analysis results of GRP78 (B), IRE1α (C), XBP1 (D), Caspase-12 (E), Caspase-3 (F), Bax (G) and Bcl-2 (H) in rat testis. β-Actin was used as a control. Data is presented as mean ± SD (n = 6). **indicates a significant difference compared to the control group at p < 0.01. ##indicates a significant difference of p < 0.01 compared to the 2 mg/kg Cd group. “−” means no specific treatment, “+” means special treatment. GRP78: glucose-regulated protein 78; IRE1α: inositol-requiring kinase 1; XBP1: X box-binding protein 1; Caspase-12: cysteine-containing aspartate hydrolase 12; Caspase-3: cysteine-containing aspartate hydrolase 3; Cd: cadmium; Que: quercetin; CdCl2: cadmium chloride.

4. Discussion

The presence of the toxic heavy metal Cd has become a global problem [21] that poses an increasingly serious health risk to animal organisms. Testicular health is crucial, as the testes serve as the primary site for sperm production and are integral to animal reproduction. Experimental studies demonstrated that Cd is seriously toxic to the testicles, causing testicular damage that manifests as hemorrhagic inflammation, organ degeneration and dysfunction, and vacuolization of spermatogenic tubules [36]. The induction of apoptotic cell damage lacks clarity regarding the underlying mechanism. Que, the most extensively ingested dietary flavonoid, has been reported to possess formidable antioxidant properties, thereby instigating the inhibition of apoptosis through diverse anti-inflammatory and alternative pathways [37]. However, its mechanism of action is not clear. Therefore, in this experiment, we established a Cd toxicity model in rat testis, using Que to affect the toxicity of Cd, and detected the changes of apoptosis related changes to provide a theoretical basis for Cd-treated testicular toxicity and the protective effect of Que.

The body weight index of animals has an important role in toxicology experiments as a commonly observed index in toxicology experiments. In the study of Tariq Iqbal et al. [38], large dose of Cd (15 mg/kg) led to a decrease in body weight in rats, compared with the control group. The same as it is in our study, significant weight loss occurred in the Cd group compared with the control group, and the decreasing body weight became more obvious as the time of treated increased. In the Cd group, body weight significantly decreased during the second, third, and fourth weeks in comparison to the control group over the corresponding time period. Particularly, there was nearly no increase in body weight during the second week. However, the overall body weight of the rats remained elevated in comparison to their weight four weeks ago. In the study conducted by YJ Wang et al. [39], the variations in body weight resulting from the different Cd treatment concentrations were consistent with our findings. Compared with that in the Cd group, the body weight of the rats in the Cd + Que group increased significantly in the third week, indicating that the toxic effect of Cd was suppressed due to the effect of Que, which has a protective effect and can significantly reduce the harm of Cd on the testicular tissue of rats. It is not uncommon to encounter instances where quercetin significantly mitigates impairment, thereby promoting weight gain [40, 41].

Histological analysis revealed significant pathological alterations in the testicular tissue cells of the Cd group when compared to the control group. These alterations included dense cytoplasmic staining and extensive liquefying necrosis of cells. Similarly, Burukoğlu and Bayçu [42] reported that Cd causes severe degeneration of rat testes, damage to spermatogenic tubules and necrosis, thus impairing reproductive capacity. In comparison with the Cd group, the Cd + Que group showed densely stained cells, and the level of damage was reduced compared with the Cd group. TUNEL staining demonstrated a significantly higher rate of cell apoptosis in Cd groups compared with the control group, and the number of apoptotic cells was significantly lower in the Cd + Que group than in the Cd group, Alizadeh and Flávia L Beltrame came to the same conclusion [43, 44].

Oxidative stress refers to the disturbance of homeostasis in the body as a result increased concentrations of ROS [21]. The introduction of Cd into the body disturbs the equilibrium between oxidation and antioxidant homeostasis, leading to oxidative stress [45]. GSH is a vital peptide compound involved in cellular defense against oxidative stress and serves as an indicator of oxidative stress. MDA, the end product of lipid peroxidation, induces harmful structural changes in macromolecules such as nucleic acids and proteins, and exhibits cytotoxic effects. Detecting the MDA content accurately reflects the degree of lipid peroxidation.

Cd induces oxidative stress in the tissues of different species, which is one of the main manifestations of its toxicity [23]. Our findings showed, that the toxic effects of Cd cause oxidative stress and lipid peroxidation in rat testis tissues, and Que significantly reduces the oxidative stress and lipid peroxidation induced by the toxic effects of Cd. While Santa Cirmi et al. [46, 47] found lower GSH content, the main reason for the significant increase in the GSH content in this experiment could be the initial stage of oxidative stress. With GSH as an anti-oxidative stress substance regulated by body homeostasis, its content increased to resist oxidative damage caused by Cd exposure [48]. While Francesca Capriglione and Jessica Maiuolo [49] reported that exposure to Cd resulted in elevated ROS, lipid peroxidation and ERS levels, indicating that Cd’s harmful impact on thyroid cells may stem from the generation of free radicals. These radicals then induce cellular damage by triggering lipid peroxidation in biofilms. In studies of Cd on chicken testes and Cd on rat ovaries, it was similarly noted that Cd was found to cause oxidative stress [25, 50]. Cd-treated oxidative stress in the brain may be a risk factor for cognitive impairment [51]. What’s more, in soybean studies, changes in Cd uptake were positively correlated with oxidative stress products [52].

IRE1, a transmembrane protein found on ER, comprises a serine and threonine kinase domain, along with a RNA endonuclease domain [53]. In its inactive state, IRE1 binds to the chaperone protein GRP78. However, during ERS, IRE1 dissociates from GRP78. Subsequently, the activation of IRE1 into phosphorylated IRE1α takes place, triggered by unfolded or misfolded proteins in the ER [54]. Upon activation, IRE1α induces splicing of XBP1 mRNA, cleaving it into split XBP1-S. Once it has bound to ERS elements situated outside the nucleus, XBP1-S can traverse the nuclear membrane and gain entry into the nucleus where it initiates the activation of target genes [55]. The initiated target genes can coordinate the function of the ER to remove unfolded or misfolded proteins. However, when ERS is not resolved, cell degeneration and death will inevitably result [56]. When ERS cannot be resolved, IRE1 and XBP1 will activate Caspase-12 and Caspaes-3, which in turn will activate Bax to induce apoptosis, while Bcl-2, an apoptosis-suppressing gene, will shows an opposite trend to Bax. First, we found that the expression of GRP78 mRNA and protein was significantly increased in the Cd group of rats, suggesting that Cd activates the ERS, and leads to UPR initiation. However, the mRNA and protein expression levels of GRP78 were significantly reduced in the Cd + Que treated group, suggesting that Que can reduces the expression of ERS initiating proteins, thereby preventing the occurrence of ERS. In addition, the up-regulation of mRNA and protein levels of IRE1α, Caspase-12, XBP1 and Caspase-3 in the Cd group compared with the control group suggests that Cd treatment activates the IRE1-XBP1 signaling pathway, which agrees with previous results [57]. Our study also found that mRNA and protein levels of IRE1α, Caspase-12, XBP1 and Caspase-3 were significantly decreased in the Cd + Que group. The ratio of Bax to Bcl-2 ultimately determines whether apoptosis occurs or not [58]. We finally have conducted a comprehensive analysis of Bax and Bcl-2 mRNA and protein expression in the testes of rats. The results obtained demonstrated a decrease in the mRNA and protein expression of the apoptosis inhibitor gene Bcl-2 in the Cd group, along with an elevation in the pro-apoptosis gene Bax. Conversely, the Cd + Que group exhibited the opposite trend. The results indicate that Cd exposure leads to apoptosis in rat testicular tissue through the IRE1-XBP1 cell apoptosis pathway, while Que can alleviate ERS and reducing cell apoptosis.

This study has limitations of research methods and sample numbers. In further research, we will add the methods of genetic knockout or pharmacological inhibition, and it is necessary to increase the sample size and explore other signaling pathways through which quercetin antagonizes cadmium induced testicular apoptosis.

5. Conclusions

In conclusion, this study showed that Cd exposure caused reduced body weight, severe oxidative damage to testicular tissue and increase of apoptosis mediated by the IRE1-XBP1 pathway in rats, while Que could reduce the damage and apoptosis (Fig. 7). Regrettably, we did not conduct sperm profile assessment as an important indicator of testicular toxicity. Nevertheless, this study offers a theoretical foundation for mitigating Cd-induced oxidative damage and apoptosis in the testis.

Effects of Que and Cd on the IRE1-XBP1 apoptotic pathway in rat 
testis. Cadmium intoxication induces oxidative stress in rat testis and 
activates the IRE1-XBP1 signaling pathway, which in turn leads to testicular cell 
apoptosis. Cadmium-induced oxidative stress and apoptosis were alleviated by the 
addition of quercetin. OS: Oxidative Stress; MDA: malondialdehyde; GSH: reducing 
glutathione; GRP78: ER chaperone-binding proteins; IRE1α: 
inositol-requiring kinase 1; XBP1: X box-binding protein 1; Caspase-12: 
cysteine-containing aspartate hydrolase 12; Caspase-3: cysteine-containing 
aspartate hydrolase 3; CdCl2: cadmium chloride.

Fig. 7.Effects of Que and Cd on the IRE1-XBP1 apoptotic pathway in rat testis. Cadmium intoxication induces oxidative stress in rat testis and activates the IRE1-XBP1 signaling pathway, which in turn leads to testicular cell apoptosis. Cadmium-induced oxidative stress and apoptosis were alleviated by the addition of quercetin. OS: Oxidative Stress; MDA: malondialdehyde; GSH: reducing glutathione; GRP78: ER chaperone-binding proteins; IRE1α: inositol-requiring kinase 1; XBP1: X box-binding protein 1; Caspase-12: cysteine-containing aspartate hydrolase 12; Caspase-3: cysteine-containing aspartate hydrolase 3; CdCl2: cadmium chloride.

Availability of data and materials

The data presented in this study are available on reasonable request from the corresponding author.

Author contributions

JBM—Conceptualization, formal analysis, data curation, writing–original draft. BX—Data curation, formal analysis. HLZ—Visualization, formal analysis. YNS—Methodology, formal analysis. WLZ—Methodology, resources. ZPL—Resources, validation, formal analysis. JCW—Conceptualization, project administration, software, writing–original draft, review, editing, funding acquisition. All authors contributed to editorial changes in the manuscript. All authors read and approved the final manuscript.

Ethics approval and consent to participate

The experimental protocol of this study complied with the ethical standards of the National Institutes of Health (NIH Publication No. 85–23, revised 1996) and was approved by the Animal Care and Ethics Committee of Henan University of Science and Technology (approval number: HAUST 2021018).

Acknowledgment

The author would like to thank the Animal Science and Technology College of Henan University of Science and Technology for providing the experimental facilities, and express gratitude to the researchers at the Environmental and Livestock Products Safety Laboratory of the College of Animal Science and Technology at Henan University of Science and Technology for their assistance and advice.

Funding

This research was funded by National Nature Science Foundation of China, grant number: 32273083, 32473106.

Conflict of interest

The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.

References

Dharmadasa P, Kim N, Thunders M. Maternal cadmium exposure and impact on foetal gene expression through methylation changes. Food and Chemical Toxicology. 2017; 109: 714–720.

[Google Scholar]

Jigyasu AK, Siddiqui S, Jafri A, Arshad M, Lohani M, Khan IA. Biological synthesis of cdte quantum dots and their anti-proliferative assessment against prostate cancer cell line. Journal of Nanoscience and Nanotechnology. 2020; 20: 3398–3403.

[Google Scholar]

Liu Y, Yuan Y, Xiao Y, Li Y, Yu Y, Mo T, et al. Associations of plasma metal concentrations with the decline in kidney function: a longitudinal study of Chinese adults. Ecotoxicology and Environmental Safety. 2020; 189: 110006.

[Google Scholar]

Stayner L, Smith R, Thun M, Schnorr T, Lemen R. A quantitative assessment of lung cancer risk and occupational cadmium exposure. IARC Scientific Publications. 1992; 447–455.

[Google Scholar]

Zhu Q, Li X, Ge RS. Toxicological effects of cadmium on mammalian testis. Frontiers in Genetics. 2020; 11: 527.

[Google Scholar]

Wang M, Chen Z, Song W, Hong D, Huang L, Li Y. A review on cadmium exposure in the population and intervention strategies against cadmium toxicity. Bulletin of Environmental Contamination and Toxicology. 2021; 106: 65–74.

[Google Scholar]

Peng L, Huang YT, Zhang F, Chen JY, Huo X. Chronic cadmium exposure aggravates malignant phenotypes of nasopharyngeal carcinoma by activating the Wnt/β-catenin signaling pathway via hypermethylation of the casein kinase 1α promoter. Cancer Management and Research. 2019; 11: 81–93.

[Google Scholar]

Lan Y, Hu L, Feng X, Wang M, Yuan H, Xu H. Synergistic effect of PS-MPs and Cd on male reproductive toxicity: ferroptosis via Keap1-Nrf2 pathway. Journal of Hazardous Materials. 2024; 461: 132584.

[Google Scholar]

de Angelis C, Galdiero G, Menafra D, Garifalos F, Verde N, Piscopo M, et al. The environment and male reproductive system: the potential role and underlying mechanisms of cadmium in testis cancer. Critical Reviews in Toxicology. 2023; 53: 412–435.

[Google Scholar]

Zhang Z, Wang Q, Gao X, Tang X, Xu H, Wang W, et al. Reproductive toxicity of cadmium stress in male animals. Toxicology. 2024; 504: 153787.

[Google Scholar]

Gao X, Li G, Pan X, Xia J, Yan D, Xu Y, et al. Environmental and occupational exposure to cadmium associated with male reproductive health risk: a systematic review and meta-analysis based on epidemiological evidence. Environmental Geochemistry and Health. 2023; 45: 7491–7517.

[Google Scholar]

Pizent A, Tariba B, Živković T. Reproductive toxicity of metals in men. Archives of Industrial Hygiene and Toxicology. 2012; 63: 35–46.

[Google Scholar]

Machado-Neves M. Effect of heavy metals on epididymal morphology and function: an integrative review. Chemosphere. 2022; 291: 133020.

[Google Scholar]

Zhang Q, Yang Y, Liu J, Wu Y, Liu Y, Zhang J. Testicular dysfunction and “its recovery effect” after cadmium exposure. Food and Chemical Toxicology. 2024; 188: 114656.

[Google Scholar]

Ikokide EJ, Oyagbemi AA, Oyeyemi MO. Impacts of cadmium on male fertility: lessons learnt so far. Andrologia. 2022; 54: e14516.

[Google Scholar]

Fitzgerald R, Olsen A, Nguyen J, Wong W, El Muayed M, Edwards J. Pancreatic islets accumulate cadmium in a rodent model of cadmium-induced hyperglycemia. International Journal of Molecular Sciences. 2020; 22: 360.

[Google Scholar]

Templeton DM, Liu Y. Multiple roles of cadmium in cell death and survival. Chemico-Biological Interactions. 2010; 188: 267–275.

[Google Scholar]

Djulejic V, Petrovic B, Jevtic J, Vujacic M, Clarke BL, Cirovic A, et al. The role of cadmium in the pathogenesis of myeloid leukemia in individuals with anemia, deficiencies in vitamin D, zinc, and low calcium dietary intake. Journal of Trace Elements in Medicine and Biology. 2023; 79: 127263.

[Google Scholar]

Fujiwara Y, Lee JY, Banno H, Imai S, Tokumoto M, Hasegawa T, et al. Cadmium induces iron deficiency anemia through the suppression of iron transport in the duodenum. Toxicology Letters. 2020; 332: 130–139.

[Google Scholar]

Bi SS, Talukder M, Sun XT, Lv MW, Ge J, Zhang C, et al. Cerebellar injury induced by cadmium via disrupting the heat-shock response. Environmental Science and Pollution Research International. 2023; 30: 22550–22559.

[Google Scholar]

Winiarska-Mieczan A. Protective effect of tea against lead and cadmium-induced oxidative stress-a review. BioMetals. 2018; 31: 909–926.

[Google Scholar]

Zwolak I. The role of selenium in arsenic and cadmium toxicity: an updated review of scientific literature. Biological Trace Element Research. 2020; 193: 44–63.

[Google Scholar]

Bhardwaj JK, Panchal H, Saraf P. Cadmium as a testicular toxicant: a review. Journal of Applied Toxicology. 2021; 41: 105–117.

[Google Scholar]

Wang J, Ding L, Wang K, Huang R, Yu W, Yan B, et al. Role of endoplasmic reticulum stress in cadmium-induced hepatocyte apoptosis and the protective effect of quercetin. Ecotoxicology and Environmental Safety. 2022; 241: 113772.

[Google Scholar]

Liu J, Luo LF, Wang DL, Wang WX, Zhu JL, Li YC, et al. Cadmium induces ovarian granulosa cell damage by activating PERK-eIF2α-ATF4 through endoplasmic reticulum stress. Biology of Reproduction. 2019; 100: 292–299.

[Google Scholar]

Rafati Rahimzadeh M, Rafati Rahimzadeh M, Kazemi S, Moghadamnia AA. Cadmium toxicity and treatment: an update. Caspian Journal of Internal Medicine. 2017; 8: 135–145.

[Google Scholar]

Chen J, Pan T, Wan N, Sun Z, Zhang Z, Li S. Cadmium-induced endoplasmic reticulum stress in chicken neutrophils is alleviated by selenium. Journal of Inorganic Biochemistry. 2017; 170: 169–177.

[Google Scholar]

Li X, Ge M, Zhu W, Wang P, Wang J, Tai T, et al. Protective effects of astilbin against cadmium-induced apoptosis in chicken kidneys via endoplasmic reticulum stress signaling pathway. Biological Trace Element Research. 2022; 200: 4430–4443.

[Google Scholar]

Andres S, Pevny S, Ziegenhagen R, Bakhiya N, Schäfer B, Hirsch-Ernst KI, et al. Safety aspects of the use of quercetin as a dietary supplement. Molecular Nutrition & Food Research. 2018; 62: 1700447.

[Google Scholar]

Moskaug JØ, Carlsen H, Myhrstad M, Blomhoff R. Molecular imaging of the biological effects of quercetin and quercetin-rich foods. Mechanisms of Ageing and Development. 2004; 125: 315–324.

[Google Scholar]

D’Andrea G. Quercetin: a flavonol with multifaceted therapeutic applications? Fitoterapia. 2015; 106: 256–271.

[Google Scholar]

Badr GM, Elsawy H, Sedky A, Eid R, Ali A, Abdallah BM, et al. Protective effects of quercetin supplementation against short-term toxicity of cadmium-induced hematological impairment, hypothyroidism, and testicular disturbances in albino rats. Environmental Science and Pollution Research International. 2019; 26: 8202–8211.

[Google Scholar]

Ding L, Zhu H, Wang K, Huang R, Yu W, Yan B, et al. Quercetin alleviates cadmium-induced BRL-3A cell apoptosis by inhibiting oxidative stress and the PERK/IRE1α/ATF6 signaling pathway. Environmental Science and Pollution Research International. 2023; 30: 125790–125805.

[Google Scholar]

Wang J, Zhu H, Wang K, Yang Z, Liu Z. Protective effect of quercetin on rat testes against cadmium toxicity by alleviating oxidative stress and autophagy. Environmental Science and Pollution Research International. 2020; 27: 25278–25286.

[Google Scholar]

Huang R, Ding L, Ye Y, Wang K, Yu W, Yan B, et al. Protective effect of quercetin on cadmium-induced renal apoptosis through cyt-c/caspase-9/caspase-3 signaling pathway. Frontiers in Pharmacology. 2022; 13: 990993.

[Google Scholar]

Unsal V, Dalkıran T, Çiçek M, Kölükçü E. The role of natural antioxidants against reactive oxygen species produced by cadmium toxicity: a review. Advanced Pharmaceutical Bulletin. 2020; 10: 184–202.

[Google Scholar]

Yang W, Liu R, Sun Q, Huang X, Zhang J, Huang L, et al. Quercetin alleviates endoplasmic reticulum stress-induced apoptosis in buffalo ovarian granulosa cells. Animals. 2022; 12: 787.

[Google Scholar]

Iqbal T, Cao M, Zhao Z, Zhao Y, Chen L, Chen T, et al. Damage to the testicular structure of rats by acute oral exposure of cadmium. International Journal of Environmental Research and Public Health. 2021; 18: 6038.

[Google Scholar]

Wang YJ, Yan J, Yin F, Li L, Qin YG, Meng CY, et al. Role of autophagy in cadmium-induced testicular injury. Human & Experimental Toxicology. 2017; 36: 1039–1048.

[Google Scholar]

Shukla P, Sahu NK, Kumar R, Dhalla DK, Rakshit S, Bhadauria M, et al. Quercetin ameliorates acute acrylamide induced spleen injury. Biotechnic & Histochemistry. 2023; 98: 221–229.

[Google Scholar]

Oyovwi MO, Oghenetega OB, Victor E, Faith FY, Uchechukwu JG. Quercetin protects against levetiracetam induced gonadotoxicity in rats. Toxicology. 2023; 491: 153518.

[Google Scholar]

Burukoğlu D, Bayçu C. Protective effects of zinc on testes of cadmium-treated rats. Bulletin of Environmental Contamination and Toxicology. 2008; 81: 521–524.

[Google Scholar]

Beltrame FL, Cerri PS, Sasso-Cerri E. Cimetidine-induced Leydig cell apoptosis and reduced EG-VEGF (PK-1) immunoexpression in rats: evidence for the testicular vasculature atrophy. Reproductive Toxicology. 2015; 57: 50–58.

[Google Scholar]

Alizadeh B, Salehzadeh A, Ranji N, Arasteh A. Effects of N-Acetyl cysteine on genes expression of c-myc, and Ask-1, histopathological, oxidative stress, inflammation, and apoptosis in the liver of male rats exposed to cadmium. Biological Trace Element Research. 2022; 200: 661–668.

[Google Scholar]

Matović V, Buha A, Ðukić-Ćosić D, Bulat Z. Insight into the oxidative stress induced by lead and/or cadmium in blood, liver and kidneys. Food and Chemical Toxicology. 2015; 78: 130–140.

[Google Scholar]

Cirmi S, Maugeri A, Micali A, Marini HR, Puzzolo D, Santoro G, et al. Cadmium-induced kidney injury in mice is counteracted by a flavonoid-rich extract of bergamot juice, alone or in association with curcumin and resveratrol, via the enhancement of different defense mechanisms. Biomedicines. 2021; 9: 1797.

[Google Scholar]

Spiazzi CC, Manfredini V, Barcellos da Silva FE, Flores EM, Izaguirry AP, Vargas LM, et al. γ-Oryzanol protects against acute cadmium-induced oxidative damage in mice testes. Food and Chemical Toxicology. 2013; 55: 526–532.

[Google Scholar]

Francis Stuart SD, Villalobos AR. GSH and zinc supplementation attenuate cadmium-induced cellular stress and stimulation of choline uptake in cultured neonatal rat choroid plexus epithelia. International Journal of Molecular Sciences. 2021; 22: 8857.

[Google Scholar]

Capriglione F, Maiuolo J, Celano M, Damante G, Russo D, Bulotta S, et al. Quercetin protects human thyroid cells against cadmium toxicity. International Journal of Molecular Sciences. 2021; 22: 6849.

[Google Scholar]

Song Y, Zhang R, Wang H, Yan Y, Ming G. Protective effect of agaricus blazei polysaccharide against cadmium-induced damage on the testis of chicken. Biological Trace Element Research. 2018; 184: 491–500.

[Google Scholar]

Karri V, Schuhmacher M, Kumar V. Heavy metals (Pb, Cd, As and MeHg) as risk factors for cognitive dysfunction: a general review of metal mixture mechanism in brain. Environmental Toxicology and Pharmacology. 2016; 48: 203–213.

[Google Scholar]

Fayazipour D, Deckert J, Akbari G, Soltani E, Chmielowska-Bąk J. Mitochondria specific antioxidant, MitoTEMPO, modulates Cd Uptake and oxidative response of soybean seedlings. Antioxidants. 2022; 11: 2099.

[Google Scholar]

Fu X, Cui J, Meng X, Jiang P, Zheng Q, Zhao W, et al. Endoplasmic reticulum stress, cell death and tumor: association between endoplasmic reticulum stress and the apoptosis pathway in tumors (Review). Oncology Reports. 2021; 45: 801–808.

[Google Scholar]

Pincus D, Chevalier MW, Aragón T, van Anken E, Vidal SE, El-Samad H, et al. BiP binding to the ER-stress sensor Ire1 tunes the homeostatic behavior of the unfolded protein response. PLOS Biology. 2010; 8: e1000415.

[Google Scholar]

Bhardwaj M, Leli NM, Koumenis C, Amaravadi RK. Regulation of autophagy by canonical and non-canonical ER stress responses. Seminars in Cancer Biology. 2020; 66: 116–128.

[Google Scholar]

Urra H, Dufey E, Lisbona F, Rojas-Rivera D, Hetz C. When ER stress reaches a dead end. Biochimica et Biophysica Acta. 2013; 1833: 3507–3517.

[Google Scholar]

Li Z, Xu T, Peng L, Tang X, Chi Q, Li M, et al. Polystyrene nanoplastics aggravates lipopolysaccharide-induced apoptosis in mouse kidney cells by regulating IRE1/XBP1 endoplasmic reticulum stress pathway via oxidative stress. Journal of Cellular Physiology. 2023; 238: 151–164.

[Google Scholar]

Zhao L, Gu Q, Xiang L, Dong X, Li H, Ni J, et al. Curcumin inhibits apoptosis by modulating Bax/Bcl-2 expression and alleviates oxidative stress in testes of streptozotocin-induced diabetic rats. Therapeutics and Clinical Risk Management. 2017; 13: 1099–1105.

[Google Scholar]