Revista Internacional de Andrología. 2025; 23(2): 42-48. doi: 10.22514/j.androl.2025.017
Original Research

Deletion mapping based on STS-PCR of Y-STR negative Chinese males
Mapa de ausencia de Y-STR negativo en hombres chinos basado en STS-PCR

Kaiwen Hou1, Mingliang Gong1, Yawen Han2, Yequan Wang1,2, Qianqian Pang1,2,*,

1Jining Medical University, 272067 Jining, Shandong, China

2Center for Forensic Science, Jining Medical University, 272067 Jining, Shandong, China

*Corresponding Author(s):pangqianqian@mail.jnmc.edu.cn (Qianqian Pang)

History Submitted: 10 July 2024 | Accepted: 06 September 2024 | Published: 30 June 2025
Copyright:  ©2025 The Author(s). Published by MRE Press.
This is an open access article under the CC BY 4.0 license (https://creativecommons.org/licenses/by/4.0/).

Collapse table of contents

Abstract

Background: In forensic genetic identification, male samples that lack the amelogenin Y-linked gene may be mistakenly genotyped as females. Therefore, in recent years, the Yindel has been integrated into multiplex polymerase chain reaction (PCR) kits designed for sex determination. Nevertheless, it has been observed that certain male individuals still exhibit negative results for these two loci or other short tandem repeat in Y chromosome (Y-STR). Methods: Y chromosome short tandem repeat (Y-STR) genotyping was performed to identify the deletion of STRs on the Y chromosome in two Chinese males. This provided a comprehensive assessment of the extent of Y chromosome deletion. The Yp11.2 deletion map was developed using Y-specific sequence-tagged sites (STSs) to verify the extent of the Yp11.2 region deletion and identify the unique deletion type in individuals at a more detailed level. Results: Y-STR genotyping revealed the presence of deletions in the DYS570 and DYS576 loci in the two Chinese males. Conclusions: We report a novel approach for detecting sites of Y chromosome deletion in Chinese males with AMELY drop-out or negative Y-STR loci. Identifying a significant number of sequence-tagged site (STS) loci enables a more systematic determination of the correlation between the deletion of different regions of the Y chromosome and the physiological and pathological characteristics. This allows for the identification of the specific role that each region of the Y chromosome plays in male ontogeny and fertility maintenance. Furthermore, this study’s deletion pattern of Y-STRs differed from other previously reported cases. Seventeen selected Y-STSs exhibited a new class of deletion patterns.This study presents a simple and efficient approach using STS loci to investigate the classification of Y chromosome short tandem repeat (Y-STR) deletions and Yp11.2 deletion patterns in Chinese males and their correlation with male fertility.

Resumen
Antecedentes: En la identificación genética forense, las muestras masculinas que carecen del gen de la cadena Y de la amelogenina pueden dividirse erróneamente en mujeres. Así, en los últimos años, Y-indel se ha integrado en kits de reacción en cadena de polimerasa múltiple (PCR) para la identificación de género. Sin embargo, se ha observado que algunos individuos masculinos siguen mostrando resultados negativos para estos dos sitios u otros secuencia repetida de tándem corto del cromosoma Y (Y-STR). Métodos: Se realizó la genotipado de la secuencia repetida de tándem corto (Y-STR) del cromosoma Y para identificar la ausencia de STR en el cromosoma y en dos hombres chinos. Esto proporciona una evaluación completa del grado de ausencia del cromosoma Y. El mapa de deleciones Yp11.2 fue desarrollado utilizando sitios de marcadores de secuencia Y específicos (STSs) para verificar el grado de deleción en la región Yp11.2 e identificar tipos únicos de deleciones en individuos a un nivel más detallado. Resultados: El genotipado Y-STR mostró deleciones en los genes DYS570 y DYS576 en dos hombres chinos. Conclusiones: Informamos un enfoque novedoso para detectar sitios de deleción del cromosoma Y en varones chinos con pérdida de AMELY o loci negativos de Y-STR. Identificar un gran número de sitios marcado por secuencia (STS) puede determinar de manera más sistemática la correlación entre la ausencia de diferentes regiones del cromosoma Y las características fisiológicas y patológicas. Esto permite identificar el papel específico de cada región del cromosoma Y en el desarrollo individual masculino y el mantenimiento de la fertilidad. Además, el patrón de ausencia de Y-STR en este estudio es diferente al de otros casos reportados anteriormente. Diecisiete y-STSs seleccionados mostraron una nueva categoría de patrones ausentes. Este estudio propone un método simple Y eficaz para estudiar la clasificación de los patrones de Deleción de secuencias repetidas de tándem corto (Y-STR) Y Deleción Yp11.2 en los cromosomas Y masculinos chinos y su correlación con la fertilidad masculina utilizando sitios STS.

Keywords:AMELY dropout;Y-STR;STS;Yp11.2 region;Deletion mapping
Palabras Clave:Pérdida de AMELY;Y-STR;STS;Área Yp11.2;Mapeo de deleciones
PDF(495.76 kB)|EndNote (RIS)|BibTeX|RefMan|RefWorks

Cite this article

Kaiwen Hou, Mingliang Gong, Yawen Han, Yequan Wang, Qianqian Pang. Deletion mapping based on STS-PCR of Y-STR negative Chinese males. Revista Internacional de Andrología. 2025; 23(2): 42-48. doi: 10.22514/j.androl.2025.017

1. Introduction

The amelogenin (AMEL) locus has been widely employed as a gender marker due to the varying sizes of the polymerase chain reaction (PCR) products of the amelogenin X-linked (AMELX) and amelogenin Y-linked (AMELY). The AMEL locus, included in commercial short tandem repeat (STR) multiplex kits, is utilized for forensic DNA profiling and gender diagnosis. However, during a criminal investigation, males with AMELY dropouts may be incorrectly identified as females when relying solely on the genotypic outcomes of the AMEL locus [1, 2, 3].

Therefore, it is recommended that AMELY dropout males should undergo Y-chromosome STR (Y-STR) genotyping. However, in some instances, the amplification of Y-STRs yielded negative results. There are typically three situations that can result in the negative amplification of Y-STRs: mutations in the primer-binding site [4, 5], fragment deletion [6, 7, 8, 9, 10, 11, 12, 13], or an abnormal Y chromosome [14, 15, 16, 17]. The primary cause of negative Y-STR amplification was identified as fragment deletion. Typically, mutations are identified by modifying the amplification kit or by designing novel primers targeting distinct chromosome regions. Eliminating several adjacent Y-STR markers signifies a fragment deletion within the pertinent genomic region. The observed dropout of numerous interspersed Y-STR markers may be attributed to a mosaic deletion. An elevated occurrence of Y-STR deletion indicates the presence of Y chromosome abnormalities [18]. Occasionally, the presence of STRs in the q arm of the Y chromosome may go undetected, typically due to the loss of the Yq region caused by Xp-Yp replacement. In some instances, there is a near absence of all Y-STRs on the Y chromosomes, which suggests that the individual has a 46, XX sex reversal syndrome [19, 20, 21, 22].

A sequence-tagged site (STS) is defined as a concise DNA sequence, typically spanning 200 to 500 base pairs, that serves as a unique molecular marker within the genome. The chromosomal locations and nucleotide sequences of STS are known. Because the genome contains a single STS copy, PCR can effectively detect it. Unlike STS markers, Y-STRs are broadly distributed across the Y chromosome. This widespread dispersion complicates the detection of deletion patterns, as it often leads to the failed amplification of Y-STR markers. Therefore, it is essential to identify the STS loci to create a deletion map in the corresponding area, offering a more comprehensive understanding of the deletion pattern of the Y chromosome [23].

As the incidence of cases involving AMELY deletion rises, there is concurrently an increase in the diversity of deletions observed in the Yp11.2 region, suggesting a degree of specificity linked to different populations (Supplementary Table 1). Hence, it is critical to characterize the Yp11.2 deletion regions. Jobling et al. [23] employed 33 Y-specific markers to study 45 AMELY-null boys from 12 populations and identified five distinct Yp11.2 deletion patterns: class I, -Is, II, III and IV [23]. Class I is the predominant category and encompasses a range of deletion types. Class I, -Is, II and III deletions are accompanied by deleting adjacent Y-STR loci, such as DYS458 and/or DYS456. It has been reported that three individuals exhibiting the class I deletion pattern in the Chinese population also had a few other deletions that could not be categorized [15, 24]. To examine the potential mutation patterns in the Chinese population, we tested the deletion region located on the Y-short arm of two Chinese males who tested negative for the AMELY gene. These tests included Y-STR analysis, examination of the sex-determining region Y (SRY), and testing of STSs.

2. Materials and methods

2.1 amples and DNA extraction

All samples (samples 1 and 2, positive and negative) were funded by the Center for Forensic Science of Jining Medical University. Samples 1 and 2 were AMELY-negative males. The extraction of DNA for AMEL and Y-STR genotyping and STS testing was performed according to the previously reported method [25].

2.2 AMEL and Y-STR genotyping

The autosomal STR and Y chromosome AMEL loci were amplified using the Goldeneye 20A PCR Amplification kit (20ADH301, Peoplespot, Beijing, China) and Huaxia™ Platinum kit (2111036, Applied Biosystems, Foster City, CA, USA), following previously published protocol [14]. For males with AMELY allele dropout, the Y filer plus kit (1903043, Applied Biosystems, Foster City, CA, USA) and Goldeneye 27YB kit (27YMI101, Peoplespot, Beijing, China) were used to verify the gender of the subjects, as described previously [14]. The amplified products were separated by capillary electrophoresis on an ABI-3500 Genetic Analyzer (Applied Biosystems, Foster City, CA, USA) and analyzed using GeneMapper ID-X1.4 software (Applied Biosystems, Foster City, CA, USA).

2.3 STS loci screening and primers designing

Samples exhibiting AMELY dropout were subjected to further analysis using SRY and STS tests to validate the gender and determine the precise locations of the deletions. The positional information of the SRY and STS markers was obtained from the University of Colombo School of Computing (UCSC) Genome database (http://genome.ucsc.edu/cgi-bin/hgTracks) and the National Center for Biotechnology Information (NCBI) database (https://www.ncbi.nlm.nih.gov/nuccore/NC_000024.10?from=2686000&to=7912000&report=genbank&strand=true). The primer sequences and annealing temperatures are listed in Table 1.

Table 1.Information of STS primers.
MarkersSequenceProduct size (bp)Annealing Temperature (°C)
SRY-FACTGGTATCCCAGCTGCTTGC22862
SRY-RAAGAGAATATTCCCGCTCTCCGG
DYS399-FCTGTAAACAAGATTGGGC32657
DYS399-RTCCATTTACTTAAAATGG
BV703954-FAAGTCATTCAGCAAGTCTCTAGGAG35357
BV703954-RTCTCAGGACAGTCAGAATGACG
BV703904-FTAATGTTGGTAGACATCAATGCAG39457
BV703904-RAAATGTTGTCCTTGGGCTTG
BV703923-FTCTCTTGTTATGCTTGTTATGCC14857
BV703923-RAAACTGTGAGGACTAAGCTGTGA
SY2137-FCTTGCTGATGTCCACCGTC25557
SY2137-RGATCCCCCCAACCCAAAT
SY716-FTTCACACAGTGGCTGAATTACTTT20857
SY716-RCATACCAGTGGGTTGCAAAA
DYS256-FCTTTGCTAGGTAAGACCCACAA30057
DYS256-RAAGCACGCCTACCTTCACCT
DYS267-FTTTTAGAGTCATTGGCCAGG13257
DYS267-RCTCTGAAAAAAAGGCAGCAG
SY2232-FAACGTGTCTGGAAAGATGGC9757
SY2232-RCAAAGATGCCTGATTGGCTC
SY2233-FGAGGCTCTCAATGCCAA8257
SY2233-RGCAGCTGCTGGTATTCCTTC
AMELY-6-1-FTGCTGATGTGGTGTGAAGTACA74557
AMELY-6-1-RTGTTCCAAAGGTAGAAGAAGGC
DYS261-FCTGGACTGCACAAAACAACA29357
DYS261-RAGAATATGGTGGGTGGGACT
DYS260-FACTAAAACACCATTAGAAACAAAGG30957
DYS260-RCTGAGCAACATAGTGACCCC
SY2220-FCATAGGAAGGGCAGTGCTTG5757
SY2220-RCCATCAGAGAAGCAAGGAGG
SY2208-FGTGAGAAGCCAACAGAAGCC5557
SY2208-RCAGAGTTTTTGTGGGCATGA
SY2207-FCCTTCACTCTCCCTCTGACG5257
SY2207-RGGGGAGTCCTCTAAACAGGG
DYS463A18-FAATTCTAGGTTTGAGCAAAGACA25457
DYS463A18-RATGAGGTTGTGTGACTTGACTG
DYS288-FTTGCTTTGCTTGTCATTTCAGA7557
DYS288-RCATTACAAATACCTGGACACTG

SRY: sex-determining region Y; AMELY: amelogenin Y-linked; bp: base pair.

2.4 PCR amplification and electrophoresis

Gradient PCR was performed to determine the optimal annealing temperature for each primer pair, employing the methodology reported in prior studies [25]. Genomic DNA extracted from blood samples was used as a template for PCR amplification. The thermal cycle conditions and method for separating amplified PCR products have been reported [25].

3. Results

3.1 Genotyping of AMEL locus and Y-STR

The STR typing of the two males with negative AMELY amplification showed AMELX amplification but not amplification of AMELY. In addition, all autosomal STR loci were successfully detected (Supplementary Fig. 1).

The genotypes of 23 Y-STR loci, except the DYS570 and DYS576 loci, were effectively retrieved from the two males using the Yfiler Plus kit and Goldeneye 27YB kit (Supplementary Fig. 2). Both males had identical Y haplotypes according to Y-STR genotype profiling. The findings indicated that the negative amplification of AMELY was likely due to a deletion in the Yp11.2 region encompassing AMELY (AMELY-DYS570-DYS576) rather than mutations in the primer binding region or abnormalities in the Y chromosome. The two AMELY-negative males were predicted to have the same haplotype (Supplementary Table 2). Based on the pedigree analysis, it can be determined that they have a common ancestry.

3.2 Analysis of STS and deletion region

Seventeen Yp11.2-specific STSs located between DYS456 and DYS458 were used to refine the deleted region in these individuals (Table 1). Six STSs, comprising DYS399, sY2208, sY2207, sY2220, DYS463A18 and DYS288, were successfully genotyped, whereas BV703954, BV703904, BV703923, sY2137, sY716, DYS256, DYS267, sY2232, sY2233, DYS261 and DYS260 were not detected in both of the AMELY-negative males (Table 2). The detection results for STS loci are shown in Table 2.

Table 2.Detection of Y-Specific loci in two male samples.
MarkersSample 1Sample 2Positon (Mb)
SRY++2.79
DYS399++4.99
BV703954++5.08
BV703904−−5.19
BV703923−−5.27
sY2137−−5.42
SY716−−5.56
DYS256−−5.75
DYS267−−6.76
sY2232−−6.79
sY2233−−6.79
AMELY-6-1−−6.87
DYS261−−7.55
DYS260−−7.72
sY2220++7.73
sY2208++7.73
sY2207++7.74
DYS463A18++7.78
DYS288++7.79

SRY: sex-determining region Y; AMELY: amelogenin Y-linked; Mb: million bases. −: negative; +: positive.

Based on the data gathered, a detailed map of the absent Yp11.2 region was constructed, as shown in Fig. 1 (Ref. [23]). It was found that the two males lacking the AMELY gene exhibited identical deleted regions. The breakpoints were confirmed to be BV703954 (5.08 Mb), BV703904 (5.19 Mb) and DYS260 (7.72 Mb)-sY2220 (7.73 Mb). Notably, both of the AMELY-negative males were determined to be fertile.

The deletion map comparison with the classification described by Jobling et al. [23]. SRY: sex-determining region Y; AMELY: amelogenin Y-linked.

Fig. 1.The deletion map comparison with the classification described by Jobling et al. [23]. SRY: sex-determining region Y; AMELY: amelogenin Y-linked.

4. Discussion

Prior research has examined several amplification kits encompassing five loci adjacent to AMELY in the Yp11.2 region: DYS393, DYS456, DYS458, DYS481 and DYS19 [26]. Deletions involving the AMELY-DYS458-DYS19 genetic sequence have been documented. Nonetheless, occurrences where deletions of DYS393 or DYS19 that include the AMELY gene are notably rare. The Y-STR genotyping results in this study revealed that all five loci were positive. The Y-STR multiplex amplification kit contained DYS570 (6.86 Mb) and DYS576 (7.09 Mb), closer to AMELY. The typing results indicated that both loci were deleted. The individuals did not possess the same Y haplotype as previously described, indicating that the deletion pattern of AMELY-DYS570-DYS576 differed from the prior findings [15, 27].

In addition to the five classical deletion categories reported by Jobling et al. [23] (2007), alternative Yp11.2 deletion patterns in AMELY-negative individuals are increasingly emerging. As an illustration, Takayama reported deleting three segments in Japanese individuals [6]. The study conducted by Jobling et al. [23] did not include testing results for Chinese male samples. Currently, the classification data for the unreported types pertaining to Chinese males has been documented only for three samples, all categorized under Class I, as shown in Supplementary Table 1 [19, 28]. However, the current study discovered that the existence of DYS456 and DYS458 indicated that the deletion pattern did not belong to Class I. A deletion map of the Yp11.2 region was developed using 17 STS loci. This map showed that 11 of these loci (BV703954, BV703904, BV703923, sY2137, sY716, DYS256, DYS267, sY2232, sY2233, DYS261, DYS260) were missing from the region between 5.19 Mb and 7.72 Mb on the Yp11.2 region. A deletion spanning approximately 2.52 Mb was identified, situated 1.68 Mb upstream and 0.85 Mb downstream of the AMELY gene. This deletion pattern does not conform to those cataloged in the report by Jobling et al. [23], suggesting it represents a novel deletion pattern that has not been previously documented or classified.

Identifying the deleted region is challenging due to the significant similarity between the breakpoints and the X chromosome, which hinders the selection of STS loci. Due to numerous palindromes in the male-specific regions of Y chromosomal deficiency, next-generation sequencing cannot identify these significant deletions.

The absence of genetic markers in the AMELY and Y-STR loci within the Yp11.2 region, specifically DYS458 and DYS456, has been extensively documented in the Chinese population. Our objective is to examine the specific type of deletion in the AMELY gene using data from prior studies conducted in China (Supplementary Table 1). However, there is a scarcity of data regarding the deletion pattern in the Yp11.2 region, and different laboratories have different STS loci for study. During the experiment, it was discovered that several primer sequences for STSs in the UCSC database were inaccurate or that there was an increased production of non-specific bands during amplification in the Chinese population. This resulted in difficulties in screening STS loci and hindered their wide usage. Therefore, the current investigation and classification of Yp11.2 regional deletion patterns in the Chinese population is complicated. This study has the potential to generate insights for the future screening of STSs, designing primer sequences, and developing amplification kits for specific regions of Y chromosomes. The integration facilitates additional investigation into the classification basis of the AMELY deletion and Yp11.2 deletion maps in the Chinese population, providing convenience [29].

The study utilizes STS-PCR technology to identify Y chromosome deletion regions and verify their physiological functions. This approach is not limited to the Yp11.2 region but can also be used in other regions of the Y chromosome. The same method can be employed to screen STS loci in different regions of the Y chromosome and establish a multiplex amplification system. An efficient method for regional division of the Y chromosome and systematic identification of its deletion can rapidly detect Y chromosome deletions in male infertility patients [30, 31], enabling early detection, swift diagnosis, and tailored treatment for male infertility patients.

5. Conclusions

In conclusion, this study provides a straightforward and effective method for detecting Y chromosome deletions using STS-PCR. This approach was used to determine the deletion range of Yp11.2 in two Chinese males. It was found that this deletion is a novel form of deletion that does not impact male reproductive capacity.

Abbreviations

AMEL, amelogenin; AMELX, amelogenin X-linked; AMELY, amelogenin Y-linked; STR, short tandem repeat; Y-STR, Y chromosome STR; STS, sequence-tagged site; SRY, sex-determining region Y; PCR, polymerase chain reaction; UCSC, University of Colombo School of Computing; NCBI, National Center for Biotechnology Information.

Availability of data and materials

The data are contained within this article (and Supplementary material).

Author contributions

QQP—designed the research study, analyzed the data and wrote the manuscript. KWH, MLG and YWH—performed the research. YQW—provided help and advice on first draft of the manuscript. All authors contributed to editorial changes in the manuscript. All authors read and approved the final manuscript.

Ethics approval and consent to participate

Bloodstains and fresh peripheral blood samples were acquired from individuals in the Chinese Han population of Jining City. The informed consent of the patients was obtained in written form. The study was conducted in accordance with the Declaration of Helsinki, and approved by the Medical Ethics Committee of Jining Medical School (JNMC-2021-YX-008).

Acknowledgment

We are grateful to all the participants, especially the AMELY-negative individual, for their kind cooperation in confirming their genotype.

Funding

This research was funded by the Project of Shandong Province Higher Educational Youth Innovation Science and Technology Program, Grant number 2022KJ106, Research Fund for Academician Lin He New Medicine, Grant number JYHL2022MS07, Undergraduate Innovation and Entrepreneurship Training Program, Grant number cx2022104z, the domestic visiting scholar project for teachers of Jining Medical University.

Conflict of interest

The authors declare no conflict of interest.

Supplementary material

Supplementary material associated with this article can be found, in the online version, at https://files.intandro.com/files/article/1938835351987470336/attachment/Supplementary%20material.docx.

References

Szczerbal I, Komosa M, Nowacka-Woszuk J, Uzar T, Houszka M, Semrau J, et al. A disorder of sex development in a holstein-friesian heifer with a rare mosaicism (60,XX/90,XXY): a genetic, anatomical, and histological study. Animals. 2021; 11: 285.

[Google Scholar]

Syndercombe Court D. The Y chromosome and its use in forensic DNA analysis. Emerging Topics in Life Sciences. 2021; 5: 427–441.

[Google Scholar]

Wei X, Song F, Wang X, Wang S, Jiang L, Zhang K, et al. Validation of the AGCU Expressmarker 20 + 20Y kit: a 6-dye multiplex assay for forensic application. Forensic Science International. 2022; 336: 111342.

[Google Scholar]

Siddique N, Shahid AA, Sughra K. Diversification of pakistani amelogenin-Y-null male haplotypes. Scientifica. 2021; 2021: 5521411.

[Google Scholar]

Precone V, Cannarella R, Paolacci S, Busetto GM, Beccari T, Stuppia L, et al. Male infertility diagnosis: improvement of genetic analysis performance by the introduction of pre-diagnostic genes in a next-generation sequencing custom-made panel. Frontiers in Endocrinology. 2021; 11: 605237.

[Google Scholar]

Takayama T, Takada N, Suzuki R, Nagaoka S, Watanabe Y, Kumagai R, et al. Determination of deleted regions from Yp11.2 of an amelogenin negative male. Legal Medicine. 2009; 11: S578–S580.

[Google Scholar]

Turrina S, Filippini G, Voglino G, De Leo D. Two additional reports of deletion on the short arm of the Y chromosome. Forensic Science International: Genetics. 2011; 5: 242–246.

[Google Scholar]

Thanh TN, Tien ST, Van PN, Thai SD, Cong TL, Le TD, et al. Optimization of multiplex-PCR technique to determine Azf deletions in infertility male patients. International Journal of General Medicine. 2024; 17: 1579–1589.

[Google Scholar]

Colaco S, Modi D. Azoospermia factor c microdeletions and outcomes of assisted reproductive technology: a systematic review and meta-analysis. Fertility and Sterility. 2024; 121: 63–71.

[Google Scholar]

Sinha MB, Rathia DS, Dada R, Sinha HP. A comprehensive analysis of Y-chromosome microdeletions and their relationship to male infertility and lifestyle variables. Cureus. 2024; 16: e57375.

[Google Scholar]

Dagwar P, Choudhary N, Shrivastava J, Kadu KS, Tyagi P, More A. Infertility challenge in a cryptozoospermic patient with Y chromosome microdeletion. Cureus. 2024; 16: e59370.

[Google Scholar]

Lee TH, Song SH, Kim DK, Shim SH, Jeong D, Kim DS. An analysis of Y-chromosome microdeletion in infertile Korean men with severe oligozoospermia or azoospermia. Investigative and Clinical Urology. 2024; 65: 77–83.

[Google Scholar]

Muncey W, Scott M, Lathi RB, Eisenberg ML. The paternal role in pregnancy loss. Andrology. 2025; 13: 146–150.

[Google Scholar]

Suntharesan J, Apperley L, Senniappan S. 45,X male—rare case of unbalanced translocation of Y chromosome to chromosome 2 presenting with developmental delay, learning difficulty and obesity. Endocrinology, Diabetes & Metabolism Case Reports. 2022; 2022: 22-0320.

[Google Scholar]

Chen W, Wu W, Cheng J, Zhang Y, Chen Y, Sun H. Detection of the deletion on Yp11.2 in a Chinese population. Forensic Science International: Genetics. 2014; 8: 73–79.

[Google Scholar]

Lai L, Huang XL, Mei DR, Li Y, Wu YC. Analysis of a Yp11.2 region deletion in a Chinese female with Turner syndrome: a case report. Heliyon. 2023; 9: e15162.

[Google Scholar]

Cioppi F, Rosta V, Krausz C. Genetics of azoospermia. International Journal of Molecular Sciences. 2021; 22: 3264.

[Google Scholar]

Chen PF, Kuan LC, Kao CC, Hsu HK, Chen M, Kuo TC, et al. Complex rearrangements of Y chromosome suggest RPS4Y1 as lymphedema candidate gene. Taiwanese Journal of Obstetrics and Gynecology. 2022; 61: 170–173.

[Google Scholar]

Xu Y, Pang Q. Repetitive DNA sequences in the human Y chromosome and male infertility. Frontiers in Cell and Developmental Biology. 2022; 10: 831338.

[Google Scholar]

Eid MM, Eid OM, Abdelrahman AH, Abdelrahman IFS, Aboelkomsan EAF, AbdelKader RMA, et al. Detection of AZFc gene deletion in a cohort of Egyptian patients with idiopathic male infertility. Journal of Genetic Engineering and Biotechnology. 2023; 21: 111.

[Google Scholar]

Qin Y, Geng F, Wen D. Generation of sex-reversed female clonal mice via CRISPR/Cas9-mediated Y chromosome deletion in male embryonic stem cells. Methods in Cell Biology. 2022; 170: 203–210.

[Google Scholar]

Zhang Y, Xu Z, Zhao X, Li L. Genetic analysis for a female carrying idic(Y)(p11.32) with disorders of sex development. Chinese Journal of Medical Genetics. 2024; 41: 626–631. (In Chinese)

[Google Scholar]

Jobling MA, Lo IC, Turner DJ, Bowden GR, Lee AC, Xue Y, et al. Structural variation on the short arm of the human Y chromosome: recurrent multigene deletions encompassing Amelogenin Y. Human Molecular Genetics. 2007; 16: 307–316.

[Google Scholar]

Xie J, Shao C, Xu H, Zhu W, Liu Z, Tang Q, et al. Deletion mapping of the regions with AMELY from two Chinese males. Legal Medicine. 2014; 16: 290–292.

[Google Scholar]

Pang Q, Lin Q, Wang D, Sun Z, Wang J. Molecular characterization of the Yp11.2 region deletion in the Chinese Han population. International Journal of Legal Medicine. 2021; 135: 1351–1358.

[Google Scholar]

Chang YM, Perumal R, Keat PY, Yong RY, Kuehn DL, Burgoyne L. A distinct Y-STR haplotype for Amelogenin negative males characterized by a large Y(p)11.2 (DYS458-MSY1-AMEL-Y) deletion. Forensic Science International. 2007; 166: 115–120.

[Google Scholar]

Jiang W, Gong Z, Rong H, Guan H, Zhang T, Zhao Y, et al. Population genetics of 26 Y-STR loci for the Han ethnic in Hunan province, China. International Journal of Legal Medicine. 2017; 131: 115–117.

[Google Scholar]

Cheng JB, Liu Q, Long F, Huang DX, Yi SH. Analysis of the Yp11.2 deletion region of phenotypically normal males with an amely-null allele in the Chinese Han population. Genetic Testing and Molecular Biomarkers. 2019; 23: 359–362.

[Google Scholar]

Krausz C, Navarro-Costa P, Wilke M, Tüttelmann F. EAA/EMQN best practice guidelines for molecular diagnosis of Y-chromosomal microdeletions: state of the art 2023. Andrology. 2024; 12: 487–504.

[Google Scholar]

Gunes S, Esteves SC. Role of genetics and epigenetics in male infertility. Andrologia. 2021; 53: e13586.

[Google Scholar]

Pandith AA, Manzoor U, Amin I, Dil-Afroze, Ahmad A, Rashid M, et al. High incidences of chromosomal aberrations and Y chromosome micro-deletions as prominent causes for recurrent pregnancy losses in highly ethnic and consanguineous population. Archives of Gynecology and Obstetrics. 2022; 305: 1393–1408.

[Google Scholar]